kmercount version 0.0.2

uio-bmi · May 2, 2024 · a2f3aa8 · a2f3aa8
1 parent 5707583
commit a2f3aa8
Show file tree

Hide file tree

Showing 2 changed files with 3 additions and 3 deletions.
diff --git a/README.md b/README.md
@@ -23,7 +23,7 @@ dependencies except for the C and C++ standard libraries.
 Here are the Kmercount options:
 
 ```
-Kmercount 0.0.1
+Kmercount 0.0.2
 
 Usage: kmercount [OPTIONS] KMERFILENAME [SEQUENCEFILENAME]
 
@@ -114,7 +114,7 @@ AAGAAATGAGAAGTAATCAGAAAACCACTTAAGG
 Output to terminal:
 
 ```
-Kmercount 0.0.1
+Kmercount 0.0.2
 
 Kmer file:         kmers.fasta
 Sequence file:     seq.fasta

diff --git a/src/main.h b/src/main.h
@@ -112,7 +112,7 @@ static_assert(INT_MAX > INT16_MAX, "Your compiler uses very short integers.");
 
 /* constants */
 
-const std::string program_version {"0.0.1"};
+const std::string program_version {"0.0.2"};
 constexpr char dash_filename {'-'};