Skip to content

bagnacan/nupack-serve

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

162 Commits
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Docker Repository on Quay

nupack-serve

Nupack-serve is a wrapper for NUPACK: a software suite for the analysis and design of nucleic acid structures, devices, and systems (Wolfe et al. 2017).
This wrapper modifies some of NUPACK's functions in order to:

  • Incoporate NUPACK within computational pipelines
  • Enhance the machine-readability of results
  • Restrict computation to CPU-bound operations

Nupack-serve was initially created to port NUPACK's mfe, complexes and concentrations within the Triplexer pipeline. However, the C functions written to remove I/O bound operation and provide provenance medatada and JSON output can be adopted by the remaining NUPACK utilities.

Motivation

NUPACK's functionalities rely on the reading/writing of files on the hard drive. This design principle is handy when results need to be overviewed by users. However, when placed within the context of computational pipelines, I/O operations can exert a negative impact on the performances of the underlying system.
For the same reason, when results are provided for human-only consultation, it becomes harder to reuse them in an automated manner. Additional programs need to be written to parse the generated output files, and this might become an additional source of errors.

Nupack-serve is a working proof-of-concept to address these limitations, and bring NUPACK functionalities to reproducible bioinformatics pipelines.
This package modifies only three of the many operations provided by NUPACK: mfe, complexes, and concentrations; which str used within the context of the Triplexer pipeline to compute the minimum free energy of secondary structures, the equilibrium base-pairing properties for each complex in a test tube, and the equilibrium concentration for each complex.

▲ back to top

Practical benefits

Following, we illustrate the benefits of this solution using NUPACK's mfe as an example.

Mfe computes the minimum free energy (MFE) secondary structure(s), of sequence(s) S over the ensemble of the complex C.
For multiple strands, mfe's command line invocation should specify the -multi flag, and provide an input file of the form FILE.in with the following information:

  1. The number of distinct strand species
  2. The sequence for each distinct strand species (each on a separate line)
  3. As many integers as the range of 1 to # of S sequences, representing the strand ordering in the complex C.

So, to compute the MFE of the complex resulting from the binding of human target gene E2F1's binding site with the two putatively cooperating miRNAs hsa-miR-205 and hsa-miR-342-3p, we have to provide the following test.in file:

3
ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu
uccuucauuccaccggagucug
ucucacacagaaaucgcacccgu
1 2 3

and call mfe with the following command line invocation:

$ mfe -multi test

NUPACK stores the result of mfe's call in a file called test.mfe, which contains the following lines:

% NUPACK 3.2.2
% Program: mfe
% Start time: Thu Apr 23 16:32:20 2020
% Command: mfe -multi test
% Sequence:  ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu+uccuucauuccaccggagucug+ucucacacagaaaucgcacccgu
% v(pi): 1
% Parameters: RNA, 1995
% Dangles setting: 1
% Temperature (C): 37.0
% Sodium concentration: 1.0000 M
% Magnesium concentration: 0.0000 M

% %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% %
99
-50.563
.((((.((((.(.(((((((((((((......)))))..((((((((((((((.+.)))))))))).))))......+.))))))))..).)))).)))).
2   98
3   97
4   96
5   95
7   93
8   92
9   91
10  90
12  88
14  85
15  84
16  83
17  82
18  81
19  80
20  79
21  78
22  37
23  36
24  35
25  34
26  33
40  70
41  69
42  68
43  67
44  65
45  64
46  63
47  62
48  61
49  60
50  59
51  58
52  57
53  56
% %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% %

This flow of execution presents limitations that we address using nupack-serve:

▲ back to top

CPU-bound execution

If we want to compute one million MFE calculations, we end up having to provide one million .in files, and obtain another million .mfe files as result. This behavior heavily impacts on performances.
For this reason, we force mfe to avoid I/O operations on disk.

$ mfe -multi
Requesting input manually.
Enter number of strands: 3 <--- automated input
Enter sequence for strand type 1:
ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu <--- automated input
Enter sequence for strand type 2:
uccuucauuccaccggagucug <--- automated input
Enter sequence for strand type 3:
ucucacacagaaaucgcacccgu <--- automated input
Enter strand permutation (e.g. 1 2 4 3 2):
1 2 3 <--- input

▲ back to top

Human and machine readability

As humans, we are able to immediately tell which parts of the resulting .mfe file are reserved to report the MFE calculation, and which to the metadata of the whole operation. However to retrieve specific details of each run, e.g. NUPACK's version, the resulting complex's sequence, or the simulation's temperature, we would need to write dedicated parsers to run against each .mfe file. This represents an additional source for errors.
For this reason, we instruct mfe to return results and provenance metadata in the JSON format.

{
  "version": "3.2.2",
  "command": "mfe -multi",
  "cutoff": 0.001,
  "sequence": "ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu+uccuucauuccaccggagucug+ucucacacagaaaucgcacccgu",
  "dangles": "1",
  "temperature (C)": 37.0,
  "concentration Na (M)": 1.0000,
  "concentration Mg (M)": 0.0000,
  "pseudoknots": false,
  "sequence length (nt)": 99,
  "minimum free energy (Kcal/mol)": -50.563,
  "dot-bracket": ".((((.((((.(.(((((((((((((......)))))..((((((((((((((..)))))))))).)))).......))))))))..).)))).))))",
  "pairs": [
    (2,98),(3,97),(4,96),(5,95),(7,93),(8,92),(9,91),(10,90),(12,88),(14,85),(15,84),(16,83),(17,82),(18,81),(19,80),(20,79),(21,78),(22,37),(23,36),(24,35),(25,34),(26,33),(40,70),(41,69),(42,68),(43,67),(44,65),(45,64),(46,63),(47,62),(48,61),(49,60),(50,59),(51,58),(52,57),(53,56)
   ]
 }

▲ back to top

Reproducibility

NUPACK has a list of software dependencies and requires users to compile its source code. While this doesn't represent a problem for the computer savvy users who have full control over their software installations, many do not fall within this category.
For this reason, we provide NUPACK's functions within a docker container.

▲ back to top

Installation requirements

The only requirement is Docker, which can be installed in different ways depending on the underlying operative system:

▲ back to top

Run nupack-serve

To run nupack-serve, you need to run its docker container. Type:

docker run -d -p 9000:8000 quay.io/bagnacan/nupack-serve

The nupack-serve app is now listening on your host's port 9000.
You can test its docker container by trying one of the provided examples.
In your browser, type:

localhost:9000

You should obtain something like this:

{
  "usage":"Nupack-serve is a wrapper for NUPACK: a software suite for the analysis and design of nucleic acid structures, devices, and systems (Wolfe et al. 2017).",
  "homepage":"https://github.com/sbi-rostock/nupack-serve",
  "license":"NUPACK Software License Agreement" <-- here cut for brevity
}

You can now:

  • Incoporate NUPACK within computational pipelines
  • Enhance the machine-readability of results (JSON)
  • Avoid read/writes to disk

▲ back to top

Usage examples

Nupack-serve wraps NUPACK's mfe, complexes and concentrations in a python application which returns:

  1. NUPACK's license agreement
  2. The exit status of the subprocess which executed the called NUPACK function
  3. Results and provenance metadata in the JSON format

We provide sample executions of nupack-serve mfe, nupack-serve complexes, and nupack-serve concentrations.
Examples refer to the physico-chemical properties of the RNA triplex formed by:

▲ back to top

With a browser

Sample nupack-serve operations are available at localhost:9000/example/{OPERATION}.

To test nupack-serve mfe, open your browser and type:

localhost:9000/example/mfe

You should obtain something like this:

{
  "license":"NUPACK Software License Agreement", <-- here cut for brevity
  "status":0, <-- exit status of the subprocess that executed mfe in the container
  "result":{ <-- mfe result
    "version":"3.2.2",
    "command":"/usr/local/bin/mfe -multi",
    "cutoff":0.001,
    "sequence":"ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu+uccuucauuccaccggagucug+ucucacacagaaaucgcacccgu",
    "dangles":"1",
    "temperature (C)":37.0,
    "concentration Na (M)":1.0,
    "concentration Mg (M)":0.0,
    "pseudoknots":false,
    "sequence length (nt)":99,
    "minimum free energy (Kcal/mol)":-50.563,
    "dot-bracket":".((((.((((.(.(((((((((((((......)))))..((((((((((((((..)))))))))).)))).......))))))))..).)))).))))",
    "pairs":[
      [2,98],[3,97],[4,96],[5,95],[7,93],[8,92],[9,91],[10,90],[12,88],[14,85],[15,84],[16,83],[17,82],[18,81],[19,80],[20,79],[21,78],[22,37],[23,36],[24,35],[25,34],[26,33],[40,70],[41,69],[42,68],[43,67],[44,65],[45,64],[46,63],[47,62],[48,61],[49,60],[50,59],[51,58],[52,57],[53,56]
    ]
  }
}

Change operation to test nupack-serve complexes and nupack-serve concentrations.

▲ back to top

With a python script

Nupack-serve operations are available at localhost:9000/{OPERATION}.

To test nupack-serve mfe, open a file test.py and write:

#!/usr/bin/env python3
import json
import requests


if __name__ == "__main__":

    parameters = {
        "number of sequences": "3",
        "target sequence": "ccgggggugaaugugugugagcaugugugugugcauguaccggggaaugaaggu",
        "mir1 sequence": "uccuucauuccaccggagucug",
        "mir2 sequence": "ucucacacagaaaucgcacccgu",
        "permutations": ["1 2 3"]
    }

    # request nupack-mfe with the defined parameterization
    response = requests.get("http://localhost:9000/mfe", data=json.dumps(parameters))

    # pretty print
    if response.status_code == 200:
        j = response.content.decode('utf8').replace("'", '"')
        data = json.loads(j)
        print(json.dumps(data, indent=4, sort_keys=True))

Then, launch it with:

$ ./test.py

You will obtain the same result as the one you obtain by pointing your browser to localhost:9000/example/mfe.

Change operation and parameterization to test nupack-serve complexes and nupack-serve concentrations.

▲ back to top

About

A wrapper for the NUPACK software suite, which removes I/O bound operations and returns results in the JSON format

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • C 70.5%
  • C++ 26.6%
  • Yacc 1.1%
  • CMake 0.6%
  • Python 0.4%
  • Lex 0.3%
  • Other 0.5%