-
Notifications
You must be signed in to change notification settings - Fork 6
Pipeline basics
Input data should be in FASTQ format. A FASTQ file has entries of four lines each:
- the sequence ID or read ID line, which is required to start with the symbol
@
- the sequence line, which contains the sequence using the characters ACGT
- a line that must begin with
+
and which can be empty of be a copy of the ID line - the quality line, whose alphabet can differ
Data I've recently gotten from the BMC is in Illumina 1.4-1.7 format:
@MISEQ:1:1101:19196:1927#CTAGAATC/1
TCGAAGTGCCAGCAGCCGCGGTAATACGTAGGGGGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGCATGGCAAGTCTGATGTGAAAACCCGCGGCTCAACCCCGGCACTGCATTGCATCCTGCCAGCCTTGAGTGCCGGTGTGGCAAGTGGAATTCCTTGTGTACCGGTGAAATGCGTACATTTCCCGAGGAACTCCAGTTCCGAAGCCGGCTTCCTGCACGATCTCTGACGTTCT
+MISEQ:1:1101:19196:1927#CTAGAATC/1
P]]PP``cecP_`PPePPO`d``OecefePO``d^dN`baddd^efedbNdd_eQcfgddN]_QQQPNONNN^]NNP^dN][aOO[PNaaaPPaPaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
This format includes the barcode read (or index read or multiplex tag) on the ID line after a #
. This is (apparently) how the Illumina pipeline exports its data for Cassava versions 1.4 through 1.8, at which time the ID line will look like
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
where the barcode is now at the very end of the line.
Note also that the quality scores here are in ascii base 64 (going from low score b
to high score h
). usearch uses base 33 (low score 1
to high score J
). However, usearch requires that the @
line end with 1
or 2
, so we use a mixed format in this pipeline.
See also: FASTQ format (wikipedia), Quality scores (usearch)
Before doing anything, you should check that your data is in an acceptable input format with check_fastq_format.py
.
Primer removal and quality filtering are both embarrassingly parallel computing tasks: every FASTQ entry can be processed independent of all the others. The pipeline might split up the FASTQ files to utilize all available CPUs for this part of the job.
The input entry above was from a run with primer sequence
ACGAAGTGCCAGCMGCCGCGGTAA
remove_primers.py
searches for this primer in the sequence line and then trims the sequence and quality lines to produce an output like
@MISEQ:1:1101:19196:1927#CTAGAATC/1
TACGTAGGGGGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGCATGGCAAGTCTGATGTGAAAACCCGCGGCTCAACCCCGGCACTGCATTGCATCCTGCCAGCCTTGAGTGCCGGTGTGGCAAGTGGAATTCCTTGTGTACCGGTGAAATGCGTACATTTCCCGAGGAACTCCAGTTCCGAAGCCGGCTTCCTGCACGATCTCTGACGTTCT
+
ecefePO``d^dN`baddd^efedbNdd_eQcfgddN]_QQQPNONNN^]NNP^dN][aOO[PNaaaPPaPaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
The primer ended on the nucleotide just below the #
on the previous line, so that's where the trimmed begins.
See also: [Removing primers]
Forward and reverse reads that came from the same molecule should have the same sequence ID. If they are long enough to overlap, they can be intersected or merged. In some cases, the merged read allows improved confidence of nucleotide values in the middle of the read where qualities are typically most poor.
The pipeline currently supports merging with usearch. It should aim to also use Sonia's SHE-RA.
usearch spits out the statistics about how well your merging went, for example::
1160817 Pairs
1020386 Converted (87.9%)
292408 Exact overlaps (25.19%)
140422 Not aligned (12.10%)
4671 Gaps
6311260 Mismatches
3327666 Fwd errs
2983594 Rev errs
9 Staggered
The usearch page has a decent explanation of quality scores of merged reads.
Every forward and reverse read has a barcode associated with it. If a read doesn't match a known barcode, that read should be thrown out. If a barcode matches a known barcode, the read is assigned to that sample.
For example, if there is a line in the barcode mapping file
HSD_group2_day15_animal7 CTAGAATC
then we can tell that the above read came from that sample, so after demultiplexing that FASTQ entry will read
@sample=HSD_group2_day15_animal7;234
TACGTAGGGGGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGCATGGCAAGTCTGATGTGAAAACCCGCGGCTCAACCCCGGCACTGCATTGCATCCTGCCAGCCTTGAGTGCCGGTGTGGCAAGTGGAATTCCTTGTGTACCGGTGAAATGCGTACATTTCCCGAGGAACTCCAGTTCCGAAGCCGGCTTCCTGCACGATCTCTGACGTTCT
+
ecefePO``d^dN`baddd^efedbNdd_eQcfgddN]_QQQPNONNN^]NNP^dN][aOO[PNaaaPPaPaBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
where 234
indicates that this was the 234th read associated with that sample. Only the first line has changed.
Every nucleotide in a read has an associated quality score. If we have low confidence in a nucleotide, we should throw it out. Reads that have poor quality overall should also be thrown out.
SmileTrain uses usearch to do quality filtering. There are some nice explanations about quality filtering parameters on the usearch website. By default, SmileTrain truncates reads based on nucleotide quality and also discards entire reads based on expected number of errors in the entire read.
The pipeline currently supports quality filtering using usearch, which spits out some nice information::
912569 FASTQ recs (912.6k)
158310 Low qual recs discarded (expected errs > 2.00)
754259 Converted (754.3k, 82.7%)
Simple dereplication looks for identical sequences and keeps only one copy. The dereplication script looks through the output from the quality filtering and keeps track of the number of times each sequence appears. It gives each sequence a unique ID and reports its sequence in a dereplicated fasta file with entries like::
>seq0;counts=123
ACGTACGT
which means that the sequence ACGTACGT
appeared 123 times and it has the new ID seq0
.
If barcodes were included, a separate index file is produced. This file keeps track of how many times each sequence occurred in each sample. It has lines like::
sample1 seq0 97
which means that, of seq0
's 123 total appearances, 97 were in sample1
.
usearch produces a .uc
file, which has a tab-separated format. The important fields are
- Field 1 :
H
(hit) orN
(no hit in the database). - Field 4 : percent identity with hit (although there is something funny here).
- Field 9 : the fasta ID
- Field 10 : the ID from the reference database
See also the full page: [OTU calling]