Skip to content

Converting 3 file input to 2 file input

Scott Olesen edited this page Aug 23, 2014 · 2 revisions

What are 2- and 3-file inputs?

Illumina sequencing centers other than the BMC give you three sequence files: a forward fastq, a reverse fastq, and an index fastq. The Smile Train is currently set up to leave Two-File Station, which means that you'll need to put the index reads into the headers of the forward and reverse reads.

A three-file format has a forward fastq with entries like

@M02171:14:000000000-A6CAE:1:1101:15953:1560 1:N:0:101
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTT
+
BBBBBBBBBBBBGGGGGGGGGGHGGGGGHHHHFFHHGGGGCDGG0EEGGGGGHHHGH

and reverse fastq like

@M02171:14:000000000-A6CAE:1:1101:15953:1560 2:N:0:101
CCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGCA
+
ABCCCFFFFFFFGGGGGG2FFGGGGGGGHHH5FH5DFHHHHHHHFHFHHHG

and an index fastq like

@M02171:14:000000000-A6CAE:1:1101:15953:1560 1:N:0:101
ACCACATACATC
+
FFFFFFFFFFFF

It is the number (1 or 2) in the front of the last few fields in the @ line that specifies the read direction (i.e., 1:N:0:101 for forward or index, 2:N:0:101 for reverse).

In a two-file format, the index read is put right into the @ line. The corresponding two-file entries for the three-file entries above would be

@M02171:14:000000000-A6CAE:1:1101:15953:1560#ACCACATACATC/1
TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTT
+
BBBBBBBBBBBBGGGGGGGGGGHGGGGGHHHHFFHHGGGGCDGG0EEGGGGGHHHGH

and

@M02171:14:000000000-A6CAE:1:1101:15953:1560#ACCACATACATC/2
CCTGTTTGCTCCCCACGCTTTCGCACCTCAGTGTCAGTATCAGTCCAGGCA
+
ABCCCFFFFFFFGGGGGG2FFGGGGGGGHHH5FH5DFHHHHHHHFHFHHHG

Note that the @ line has no whitespace, the barcode read comes after the # and before the /, and either 1 or 2 follows the / to indicate read direction.

What scripts to run

There is a utility script that will do this. To convert for.fastq, rev.fastq, and ind.fastq into new fastqs new_for.fastq and new_rev.fastq, issue

/path/to/SmileTrain/tools/convert_3file_to_2file.py for.fastq rev.fastq ind.fastq new_for.fastq new_rev.fastq

This can be a little slow, so be sure to not run it on the head node.

What if there is some complaint about unequal quality and sequence lengths?

I've seen some cases where the all the index read entries have a quality score line that has a different length from the sequence line. If you think this is just an artifact of the Illumina pipeline and you actually trust those index reads, you can run fix_index_fastq.py to either pad or trim the quality score line as necessary.

/path/to/SmileTrain/tools/fix_index_fastq.py old_index.fastq > new_index.fastq

Clone this wiki locally