merge with current master

Author: antgonza

qiita_pet/handlers/study_handlers/base.py

@@ -23,6 +23,7 @@ def get(self, study_id):
         study = to_int(study_id)
         level = self.get_argument('level', '')
         message = self.get_argument('message', '')
+        prep_id = self.get_argument('prep_id', default=None)
 
         study_info = study_get_req(study, self.current_user.id)
         if study_info['status'] != 'success':
@@ -32,6 +33,25 @@ def get(self, study_id):
             study_info['level'] = level
             study_info['message'] = message
 
+        if prep_id:
+            msg = f"'{prep_id}' is not a valid preparation for this study"
+            study_info['study_info']['prep_id'] = to_int(prep_id, msg)
+
+            # prep_id is an integer - confirm that it's a valid prep_id.
+            prep_info = study_prep_get_req(study, self.current_user.id)
+            if prep_info['status'] != 'success':
+                raise HTTPError(404, reason=prep_info['message'])
+
+            prep_ids = []
+            for prep_type in prep_info['info']:
+                # prep_type will be either '18S', '16S', or similarly named.
+                # generate a list of prep-ids from the preps in each list.
+                prep_ids += [x['id'] for x in prep_info['info'][prep_type]]
+
+            if study_info['study_info']['prep_id'] not in prep_ids:
+                raise HTTPError(400, reason=(f"'{prep_id}' is not a valid "
+                                             "preparation for this study"))
+
         self.render("study_base.html", **study_info)
 
 

qiita_pet/handlers/study_handlers/tests/test_base.py

@@ -17,11 +17,18 @@ class StudyIndexHandlerTests(TestHandlerBase):
     def test_get_exists(self):
         response = self.get('/study/description/1')
         self.assertEqual(response.code, 200)
+        self.assertTrue('study/description/baseinfo' in str(response.body))
 
     def test_get_no_exists(self):
         response = self.get('/study/description/245')
         self.assertEqual(response.code, 404)
 
+    def test_get_prep_page(self):
+        response = self.get('/study/description/1?prep_id=1')
+        self.assertEqual(response.code, 200)
+        self.assertTrue('study/description/prep_template' in
+                        str(response.body))
+
 
 class StudyBaseInfoAJAX(TestHandlerBase):
     # TODO: Missing tests

qiita_pet/handlers/util.py

@@ -81,7 +81,7 @@ def download_link_or_path(is_local_request, filepath, fp_id, label):
     linkify, "<a target=\"_blank\" href=\"http://dx.doi.org/{0}\">{0}</a>")
 
 
-def to_int(value):
+def to_int(value, reason=None):
     """Transforms `value` to an integer
 
     Parameters
@@ -102,8 +102,9 @@ def to_int(value):
     try:
         res = int(value)
     except ValueError:
-        raise HTTPError(400, reason="%s cannot be converted to an "
-                        "integer" % value)
+        msg = f"{value} cannot be converted to an integer" if reason is None \
+              else reason
+        raise HTTPError(400, reason=msg)
     return res
 
 

qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst

@@ -6,7 +6,7 @@ Currently, Qiita supports the processing of raw data from:
 #. Target gene barcoded sequencing
 #. Shotgun sequencing
 #. Metatranscriptome sequencing
-#. Genome Isolate sequencing
+#. Genome isolate sequencing
 
 Note that the selected processing recommendations are mainly guided towards performing meta-analyses,
 this is combine different studies, even from different wet lab techniques or
@@ -63,19 +63,19 @@ The current workflow is as follows:
 
 Note that we recommend only uploading sequences that have already been through QC and human sequence removal. However, we
 recommend that all sequence files go through adapter and host filtering within the system to ensure they are ready for
-subsequent meta-analyses. Currently, the `fastp` command is set to autodetect adaptors so this command is available for all different
-wetlab processing and we provide the following host references for your convenience:
-
-- auto-detect adapters and artifacts + phix filtering: This is a `deblur artifacts <https://github.com/biocore/deblur/blob/master/deblur/support_files/artifacts.fa>`_ reference, mainly for debugging and testing
-- auto-detect adapters and `cheetah <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/003/709/585/GCF_003709585.1_Aci_jub_2/GCF_003709585.1_Aci_jub_2_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `cow <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/003/205/GCA_000003205.6_Btau_5.0.1/GCA_000003205.6_Btau_5.0.1_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `hamster <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/017/639/785/GCF_017639785.1_BCM_Maur_2.0/GCF_017639785.1_BCM_Maur_2.0_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `horse <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/002/305/GCA_000002305.1_EquCab2.0/GCA_000002305.1_EquCab2.0_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `mouse <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/001/635/GCF_000001635.27_GRCm39/GCF_000001635.27_GRCm39_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `pig <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/025/GCF_000003025.6_Sscrofa11.1/GCF_000003025.6_Sscrofa11.1_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `rabbit <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/625/GCF_000003625.3_OryCun2.0/GCF_000003625.3_OryCun2.0_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters and `rat <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/895/GCA_000001895.4_Rnor_6.0/GCA_000001895.4_Rnor_6.0_genomic.fna.gz>`_ + phix filtering
-- auto-detect adapters only filtering
+subsequent meta-analyses. We currently provide the several options for your convenience. For each the `fastp` command is set to autodetect and remove universal adapter sequences (i.e., 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' for R1 reads and 'GATCGGAAGAGCGTCGTGTAGGGAAAGGAGTGT' for R2 reads). We also provide the following host reference genomes for filtering against; each also filters against three phi x sequences (i.e., `HM753704.1 <https://www.ncbi.nlm.nih.gov/nuccore/HM753704.1/>`_, `JF719728.1 <https://www.ncbi.nlm.nih.gov/nuccore/JF719728.1>`_, `J02482.1 <https://www.ncbi.nlm.nih.gov/nuccore/J02482.1>`_):
+
+- auto-detect adapters and artifacts + phix filtering: This is a `deblur artifacts <https://github.com/biocore/deblur/blob/master/deblur/support_files/artifacts.fa>`_ reference, mainly for debugging and testing. Includes another adapter sequence (i.e., 'ATCTCGTATGCCGTCTTCTGC').
+- auto-detect adapters and **cheetah** + phix filtering. Includes cheetah (*Acinonyx jubatus*) reference `GCF_003709585.1 (Aci_jub_2) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_003709585.1/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/003/709/585/GCF_003709585.1_Aci_jub_2/GCF_003709585.1_Aci_jub_2_genomic.fna.gz>`_
+- auto-detect adapters and **cow** + phix filtering. Includes cow (*Bos taurus*) reference `GCF_000003205.7 (Btau_5.0.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003205.7/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/003/205/GCA_000003205.6_Btau_5.0.1/GCA_000003205.6_Btau_5.0.1_genomic.fna.gz>`_
+- auto-detect adapters and **hamster** + phix filtering. Includes golden hamster (*Mesocricetus auratus*) reference `GCF_017639785.1 (BCM_Maur_2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_017639785.1/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/017/639/785/GCF_017639785.1_BCM_Maur_2.0/GCF_017639785.1_BCM_Maur_2.0_genomic.fna.gz>`_
+- auto-detect adapters and **horse** + phix filtering. Includes horse (*Equus caballus*) reference `GCF_000002305.2 (EquCab2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000002305.2/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/002/305/GCA_000002305.1_EquCab2.0/GCA_000002305.1_EquCab2.0_genomic.fna.gz>`_
+- auto-detect adapters and **merge_genomes** + phix filtering. Includes the genomes of cheetah, cow, hamster, horse, mouse, pig, rabbit, and rat described here.
+- auto-detect adapters and **mouse** + phix filtering. Includes house mouse (*Mus musculus*) reference `GCF_000001635.27 (GRCm39) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001635.27/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/001/635/GCF_000001635.27_GRCm39/GCF_000001635.27_GRCm39_genomic.fna.gz>`_
+- auto-detect adapters and **pig** + phix filtering. Includes pig (*Sus scrofa*) reference `GCF_000003025.6 (Sscrofa11.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003025.6/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/025/GCF_000003025.6_Sscrofa11.1/GCF_000003025.6_Sscrofa11.1_genomic.fna.gz>`_
+- auto-detect adapters and **rabbit** + phix filtering. Includes rabbit (*Oryctolagus cuniculus*) reference `GCF_000003625.3 (OryCun2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003625.3/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/625/GCF_000003625.3_OryCun2.0/GCF_000003625.3_OryCun2.0_genomic.fna.gz>`_
+- auto-detect adapters and **rat** + phix filtering. Includes Norway rat (*Rattus norvegicus*) reference `GCF_000001895.5 (Rnor_6.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001895.5/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/895/GCA_000001895.4_Rnor_6.0/GCA_000001895.4_Rnor_6.0_genomic.fna.gz>`_
+- auto-detect adapters only filtering. Only includes the two adapter sequences noted above.
 
 Note that the command produces up to 6 output artifacts based on the aligner and database selected:
 

qiita_pet/templates/study_ajax/sample_prep_summary.html

@@ -6,7 +6,7 @@
   var column_width_factor = 10;
   var rows = {% raw list(rows.values()) %};
   // setting up checkboxes
-  var prep_colums = jQuery.map(
+  var prep_columns = jQuery.map(
     Object.keys(rows[0]), function(e) { if (e.startsWith("prep")) return e });
   for(var i=0;i<rows.length;i++) {
     rows[i]['sample-delete'] = '';
@@ -19,13 +19,19 @@
     });
   }
   function toggleCheckbox(element){
-    var checked = element.checked ? 'checked' : '';
-    var row = $(element).prop('value');
-    rows[row]["sample-delete"] = checked;
-  }
+    if(element['sample-delete'] == 'checked') {
+      element['sample-delete'] = '';
+      // if user clicks inside row and column, but not in checkbox, this will force checkbox to change.
+      $('.sample-delete[name="' + element['sample'] + '"]').prop('checked', '');
+    } else {
+      element['sample-delete'] = 'checked';
+      // if user clicks inside row and column, but not in checkbox, this will force checkbox to change.
+      $('.sample-delete[name="' + element['sample'] + '"]').prop('checked', 'checked');
+    };
+    }
   function linkFormatter(row, cell, value, columnDef, dataContext) {
     {% if user_can_edit %}
-      return "<input type='checkbox' class='sample-delete' value='" + row + "' name='" + rows[row]['sample'] + "' onchange='toggleCheckbox(this)' " + rows[row]['sample-delete'] + ">";
+      return "<input type='checkbox' class='sample-delete' value='" + row + "' name='" + rows[row]['sample'] + "'>";
     {% else %}
       return ""
     {% end %}
@@ -44,7 +50,7 @@
       var to_delete = [];
       $.each(rows, function(i, row){
         var sample_delete = jQuery.map(
-          prep_colums, function(pc) { if (row[pc] === 'X') return pc });
+          prep_columns, function(pc) { if (row[pc] === 'X') return pc });
         if (sample_delete.length === 0){
           to_delete.push(row['sample'])
         }
@@ -64,15 +70,15 @@
 
     // adding header
     var header = ['sample_name']
-    $.each(prep_colums, function(i, prep){
+    $.each(prep_columns, function(i, prep){
       header.push(prep_names[prep]);
     });
     information.push(header.join('\t'))
 
     // adding data
     $.each(rows, function (i, row){
       var line = [row['sample']]
-      $.each(prep_colums, function(i, prep){
+      $.each(prep_columns, function(i, prep){
         line.push(row[prep]);
       });
       information.push(line.join('\t'));
@@ -116,6 +122,12 @@
 		grid.invalidate();
     grid.render();
 	});
+  grid.onClick.subscribe(function(e, args){
+    let cell = grid.getCellFromEvent(e);
+    if(grid.getColumns()[cell.cell].id == "sample-delete") {
+        toggleCheckbox(grid.getDataItem(cell.row))
+      }
+    });
 
   function add_meta() {
     var metadata_category = $("#metadata_category").val();

qiita_pet/templates/study_base.html

@@ -64,7 +64,11 @@
     // Populate the different sections of the page
     populate_data_type_menu_div();
     // The initial page to be shown is the base information of the study
-    populate_main_div("{% raw qiita_config.portal_dir %}/study/description/baseinfo/", { study_id: {{study_info['study_id']}}});
+    {% if 'prep_id' in study_info %}
+        populate_main_div("{% raw qiita_config.portal_dir %}/study/description/prep_template/", { prep_id: {{study_info['prep_id']}}, study_id: {{study_info['study_id']}}});
+    {% else %}
+        populate_main_div("{% raw qiita_config.portal_dir %}/study/description/baseinfo/", { study_id: {{study_info['study_id']}}});
+    {% end %}
 
     {% if study_info['num_samples'] > 0 %}
       $("#sample-summary-btn").show();