Implements phylogenetic inference for data with repeated sequences, as described in:
DeWitt, Mesin, Victora, Minin and Matsen, Using genotype abundance to improve phylogenetic inference, arXiv:1708.08944.
Two programs are implemented:
- an inference program for experimental input data in
FASTA
orPHYLIP
format (including an additional sequence for the ancestral state) - a simulation/inference/validation program
All commands should be issued from within the gctree repo directory.
- For installing dependencies, conda environment management is recommended. First install conda or miniconda.
- Create a python 3.7 conda environment (named gctree in this example):
conda create --name gctree python=3.7 -c bioconda -c etetoolkit -c conda-forge -c cswarth python=3.7 ete3 biopython matplotlib pandas scipy scons seaborn nestly phylip seqmagick
- Activate the environment:
conda activate gctree
- Install jellyfish for faster string comparison (optional)
conda install -c conda-forge jellyfish
- input file:
FASTA
orPHYLIP
file containing a sequence for each observed individual/cell, and an additional sequence containing the ancestral genotype of all observed sequences (used for outgroup rooting). - run inference:
scons --inference --outdir=<output directory path> --input=<input FASTA or PHYLIP file> --naiveID=<id of ancestral sequence in input file>
- description of inference output files: After the inference pipeline has completed, the output directory will contain the following output files:
<input file>.idmap
: text file mapping collapsed sequenced ids to cell ids from the original input file<input file>.counts
: text file mapping collapsed sequenced ids to their abundances<input file>.phylip
: phylip alignment file of collapsed sequences for computing parsimony treesdnapars/
: directory of parsimony tree output from PHYLIP's dnaparsgctree.inference.*.svg
: rendered tree images for each of the parsimony treesgctree.inference.abundance_rank.pdf
: histogram of genotype abundancesgctree.inference.likelihood_rank.pdf
: rank plot of GCtree likelihoods for the parsimony treesgctree.inference.log
: log file containing parameter fits, numerical likelihood results, and any other program messagesgctree.inference.parsimony_forest.p
: a python pickle file containing the parsimony trees asCollapsedTree
objects
scons --simulate --outdir=<output directory path> --N=<integer population size to simulate>
-
Example input data set
example/150228_Clone_3-8.fasta
contains heavy chain V gene sequences from 65 germinal B cells sorted from a brainbow mouse using multicolor fate mapping.$ head example/150228_Clone_3-8.fasta >VIBM1S4A05IgG ggacctagcctcgtgaaaccttctcagactctgtccctcacctgttctgtcactggcgac tccatcaccagtggttactggaactggatccggaagttcccagggaatagacttgagtac atggggtacataagcttcagtggtggtacttactacaatccatctctcaaaagtcgaatc tccatcactcgagacacatccaagaaccagtaccacctgcagttgaattctgtgactact gaggacacagccacatattactgt >VIBM1S4A06IgG ggacctagcctcgtgaaaccttctcagactctgtccctcacctgttctgtcactggcgac tccatcaccagtggttactggaactggatccggaagttcccagggaatagacttgagtac atggggtacataagcttcagtggtagcacttactacaatccatctctcaaaagtcgaatc
These data were published in Tas et al. 2016. Visualizing Antibody Affinity Maturation in Germinal Centers. Science 351 (6277)) and shown in Fig. 4 (lymph node 2, germinal center 1).
-
Run inference
From within the
gctree
repository directory:scons --inference --input=example/150228_Clone_3-8.fasta --outdir=test --converter=tas --naiveID=GL --jobs=2
This command will produce output in subdirectory
test/
. This includes a log file with some messages about results (including the number of trees and the fitted branching process parameters), and then lists each parsimony tree by decreasing likelihood (with tree 1 corresponding to the GCtree MLE).$ head test/gctree.inference.log number of trees with integer branch lengths: 58 58 trees exhibit unobserved unifurcation from root. Adding psuedocounts to these roots params = [0.4961832081885355, 0.36484189590092164] tree alleles logLikelihood 1 48 -79.016217483 2 48 -79.016217483 3 48 -80.0883965146 4 48 -80.1148297716 5 49 -80.3507858934 6 49 -80.3507858934
For each tree, the directory will include an SVG file rendering of the tree. E.g. the MLE
test/gctree.inference.1.svg
:There is also a rank plot of genotype abundance
test/gctree.inference.abundance_rank.png
:and of GCtree likelihood over the trees
test/gctree.inference.likelihood_rank.png
:Finally, there are text files indicating abundance of each unique sequence,
$ head test/150228_Clone_3-8.counts seq22,3 seq23,1 seq20,1 seq21,1 seq26,1 seq27,1 seq24,1 seq25,1 seq28,1 seq29,1
the mapping of unique sequence ids to the sequence ids in the input
FASTA
,$ head test/150228_Clone_3-8.idmap seq22,VIBM1S4B10IgG:VIBM1S4C09IgG:VIBM1S4H12IgG seq23,VIBM1S4E03IgG seq20,VIBM1S4D02IgG seq21,VIBM1S4A05IgG seq26,VIBM1S4F11IgG seq27,VIBM1S4E12IgG seq24,VIBM1S4B03IgG seq25,VIBM1S4D05IgG seq28,VIBM1S4G04IgG seq29,VIBM1S4E09IgG
and the
PHYLIP
alignment of the unique sequences,$ head test/150228_Clone_3-8.phylip 43 264 gl ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq1 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq2 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq3 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq4 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq5 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq6 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq7 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt seq8 ggacctagcc tcgtgaaacc ttctcagact ctgtccctca cctgttctgt
When using the optional
--idlabel
flag, which shows labelsseq1, seq2, ...
in the tree rendering (see documentation below), these id/sequence files can be used to associate DNA sequences or cell labels with specific tree nodes. -
Explanation of arguments
--outdir=test
specifies that results are to be saved in directorytest/
(which will be created if it does not exist)--converter=tas
argument means that integer sequence IDs in the input file are interpreted as abundances. The example inputFASTA
includes a sequence with id "17".--naiveID=GL
indicates that the root naive sequence has id "GL" in the inputFASTA
. This sequence is the germline sequence of the V gene used in the V(D)J rearrangement that defines this clonal family.--jobs=2
indicates that 2 parallel processes should be usedIf running on a remote machine via ssh, it may be necessary to provide the flag
--xvfb
which will allow X rendering of ETE trees without X forwarding.
scons --inference ...
--input=[path]
path to FASTA
or PHYLIP
input alignment
--outdir=[path]
directory for output (created if does not exist)
--naiveID=[string]
ID of naive sequence in input file used for outgroup rooting, default 'naive'. For BCRs, we assume a known naive V(D)J rearrangemnt is an additional sequence in our alignment, regardless of whether it was observed or not. This ancestral sequence must appear as an additional sequence. For applications without a definite root state, an observed sequence can be used to root the tree by duplicating it in the alignment and giving it a new id, which can be passed as this argument.
--colorfile=[path]
path to a file of plotting colors for cells in the input file. Example, if the input file contains a sequence with ID cell_1
, this cell could be colored red in the tree image by including the line cell_1,red
in the color file.
--bootstrap=[int]
boostrap resampling, and inference on each, default no bootstrap
--converter=[string]
if set to "tas", parse input IDs that are integers as indicating sequence abundance. Otherwise each line in the input is assumed to indicate an individual (non-deduplicated) sequence. NOTE: the example input FASTA
file example/150228_Clone_3-8.fasta
requires this option.
scons --simulation ...
--N=[int]
populaton size to simulate. Note that N=1
is satisfied before the first time step, so this choice will return the root with no mutation.
--outdir=[path]
directory for output (created if does not exist)
--naive=[string]
DNA sequence of naive sequence from which to begin simulating, a default is used if omitted
--mutability=[path]
path to S5F mutability file, default 'S5F/mutability'
--substitution=[path]
path to S5F substitution file, default 'S5F/substitution'
--lambda=[float, float, ...]
values for Poisson branching parameter for simulation, default 2.0
--lambda0=[float, float, ...]
values for baseline mutation rate, default 0.25
--T=[int]
time steps to simulate (alternative to --N
)
--nsim=[int]
number of simulation of each set of parameter combination, default 10
--n=[int]
number of cells to sample from final population, default all
--jobs=[int]
number of parallel processes to use
--srun
should cluster jobs be submitted with Slurm's srun?
--frame=[int]
codon reading frame, default None
--quick
less thorough parsimony tree search (faster, but smaller parsimony forest)
--idlabel
label sequence IDs on tree, and write FASTA
alignment of distinct sequences. The mapping of the unique names in this FASTA
file to the cell names in the original input file can be found in the output file with suffix .idmap
--xvfb
needed for X rendering in on remote machines
- Try setting the above option if you get the error:
ETE: cannot connect to X server
Underlying both pipelines is the gctree.py
Python library (located in the bin/
subdirectory) for simulating and compute likelihoods for collapsed trees generated from a binary branching process with mutation and infinite types, as well as forests of such trees. General usage info gctree.py --help
. There are three subprograms, each of which has usage info:
gctree.py infer --help
: takes anoutfile
file made by phylip'sdnapars
as a command line argument, converts each tree therein to a collapsed tree, and ranks by GCtree likelihood.gctree.py simulate --help
: simulate datagctree.py test --help
: performs tests of the likelihood and outputs validation plots.
The under-the-hood functionality of the gctree.py
library might be useful for some users trying to go beyond the scons pipelines. For example mapping colors to tree image nodes can be achieved with the --colormap
argument. Colors can be useful for visualizing other cell/genotype properties on the tree.
--igphyml
include results for tree inference with the IgPhyML package
--dnaml
include results for maximum likelihood tree inference using dnaml
from the PHYLIP package
--nogctree
do not perform gctree inference
--selection
simulation with affinity selection
--target_dist
distance to selection target
--target_count
number of targets
--verbose
verbose printing
--carry_cap
carrying capacity of germinal center
--skip_update
skip update step
-
IgPhyML (https://github.com/kbhoehn/IgPhyML)
- Needs to be in $PATH
-
perl5, with modules:
- PDL
- PDL::LinearAlgebra::Trans
-
installing python and perl dependencies *
sudo apt-get install python-pip scons
pip install --user ete3 seaborn numpy scipy matplotlib pandas biopython nestly
cpan
> install PDL
> install PDL::LinearAlgebra::Trans