Merge pull request #436 from Aman-Godara/replace_all

implemented low-level replace_all function

Author: awvwgk

doc/specs/stdlib_strings.md

@@ -283,7 +283,6 @@ Default value of `occurrence` is set to `1`.
 If `consider_overlapping` is not provided or is set to `.true.` the function counts two overlapping occurrences of substring as two different occurrences.  
 If `occurrence`th occurrence is not found, function returns `0`.
 
-
 #### Syntax
 
 `string = [[stdlib_strings(module):find(interface)]] (string, pattern [, occurrence, consider_overlapping])`
@@ -318,7 +317,7 @@ program demo_find
   use stdlib_string_type, only: string_type, assignment(=)
   use stdlib_strings, only : find
   implicit none
-  string_type :: string
+  type(string_type) :: string
 
   string = "needle in the character-stack"
 
@@ -328,3 +327,58 @@ program demo_find
 
 end program demo_find
 ```
+
+
+<!-- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -- -->
+### `replace_all`
+
+#### Description
+
+Replaces all occurrences of substring `pattern` in the input `string` with the replacement `replacement`.  
+Occurrences overlapping on a base occurrence will not be replaced.
+
+#### Syntax
+
+`string = [[stdlib_strings(module):replace_all(interface)]] (string, pattern, replacement)`
+
+#### Status
+
+Experimental
+
+#### Class
+
+Pure function
+
+#### Argument
+
+- `string`: Character scalar or [[stdlib_string_type(module):string_type(type)]].
+  This argument is intent(in).
+- `pattern`: Character scalar or [[stdlib_string_type(module):string_type(type)]].
+  This argument is intent(in).
+- `replacement`: Character scalar or [[stdlib_string_type(module):string_type(type)]].
+  This argument is intent(in).
+
+#### Result value
+
+The result is of the same type as `string`.
+
+#### Example
+
+```fortran
+program demo_replace_all
+  use stdlib_string_type, only: string_type, assignment(=)
+  use stdlib_strings, only : replace_all
+  implicit none
+  type(string_type) :: string
+
+  string = "hurdles here, hurdles there, hurdles everywhere"
+  ! string <-- "hurdles here, hurdles there, hurdles everywhere"
+
+  print'(a)', replace_all(string, "hurdles", "learn from")
+  ! "learn from here, learn from there, learn from everywhere"
+
+  string = replace_all(string, "hurdles", "technology")
+  ! string <-- "technology here, technology there, technology everywhere"
+
+end program demo_replace_all
+```

src/stdlib_strings.f90

@@ -12,7 +12,7 @@ module stdlib_strings
 
     public :: strip, chomp
     public :: starts_with, ends_with
-    public :: slice, find
+    public :: slice, find, replace_all
 
 
     !> Remove leading and trailing whitespace characters.
@@ -79,6 +79,20 @@ module stdlib_strings
         module procedure :: find_char_char
     end interface find
 
+    !> Replaces all the occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Version: experimental
+    interface replace_all
+        module procedure :: replace_all_string_string_string
+        module procedure :: replace_all_string_string_char
+        module procedure :: replace_all_string_char_string
+        module procedure :: replace_all_char_string_string
+        module procedure :: replace_all_string_char_char
+        module procedure :: replace_all_char_string_char
+        module procedure :: replace_all_char_char_string
+        module procedure :: replace_all_char_char_char
+    end interface replace_all
+
 contains
 
 
@@ -353,7 +367,7 @@ pure function slice_char(string, first, last, stride) result(sliced_string)
         end if
 
         if (present(first)) then
-            first_index =  first
+            first_index = first
         end if
         if (present(last)) then
             last_index = last
@@ -499,5 +513,140 @@ pure function compute_lps(string) result(lps_array)
 
     end function compute_lps
 
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_string_string_string(string, pattern, replacement) result(res)
+        type(string_type), intent(in) :: string
+        type(string_type), intent(in) :: pattern
+        type(string_type), intent(in) :: replacement
+        type(string_type) :: res
+
+        res = string_type(replace_all(char(string), & 
+                & char(pattern), char(replacement)))
+
+    end function replace_all_string_string_string
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_string_string_char(string, pattern, replacement) result(res)
+        type(string_type), intent(in) :: string
+        type(string_type), intent(in) :: pattern
+        character(len=*), intent(in) :: replacement
+        type(string_type) :: res
+
+        res = string_type(replace_all(char(string), char(pattern), replacement))
+
+    end function replace_all_string_string_char
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_string_char_string(string, pattern, replacement) result(res)
+        type(string_type), intent(in) :: string
+        character(len=*), intent(in) :: pattern
+        type(string_type), intent(in) :: replacement
+        type(string_type) :: res
+
+        res = string_type(replace_all(char(string), pattern, char(replacement)))
+
+    end function replace_all_string_char_string
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_char_string_string(string, pattern, replacement) result(res)
+        character(len=*), intent(in) :: string
+        type(string_type), intent(in) :: pattern
+        type(string_type), intent(in) :: replacement
+        character(len=:), allocatable :: res
+
+        res = replace_all(string, char(pattern), char(replacement))
+
+    end function replace_all_char_string_string
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_string_char_char(string, pattern, replacement) result(res)
+        type(string_type), intent(in) :: string
+        character(len=*), intent(in) :: pattern
+        character(len=*), intent(in) :: replacement
+        type(string_type) :: res
+
+        res = string_type(replace_all(char(string), pattern, replacement))
+
+    end function replace_all_string_char_char
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_char_string_char(string, pattern, replacement) result(res)
+        character(len=*), intent(in) :: string
+        type(string_type), intent(in) :: pattern
+        character(len=*), intent(in) :: replacement
+        character(len=:), allocatable :: res
+
+        res = replace_all(string, char(pattern), replacement)
+
+    end function replace_all_char_string_char
+
+    !> Replaces all occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_char_char_string(string, pattern, replacement) result(res)
+        character(len=*), intent(in) :: string
+        character(len=*), intent(in) :: pattern
+        type(string_type), intent(in) :: replacement
+        character(len=:), allocatable :: res
+
+        res = replace_all(string, pattern, char(replacement))
+
+    end function replace_all_char_char_string
+
+    !> Replaces all the occurrences of substring 'pattern' in the input 'string'
+    !> with the replacement 'replacement'
+    !> Returns a new string
+    pure function replace_all_char_char_char(string, pattern, replacement) result(res)
+        character(len=*), intent(in) :: string
+        character(len=*), intent(in) :: pattern
+        character(len=*), intent(in) :: replacement
+        character(len=:), allocatable :: res
+        integer :: lps_array(len(pattern))
+        integer :: s_i, p_i, last, length_string, length_pattern
+
+        res = ""
+        length_string = len(string)
+        length_pattern = len(pattern)
+        last = 1
+        
+        if (length_pattern > 0 .and. length_pattern <= length_string) then
+            lps_array = compute_lps(pattern)
+
+            s_i = 1
+            p_i = 1
+            do while (s_i <= length_string)
+                if (string(s_i:s_i) == pattern(p_i:p_i)) then
+                    if (p_i == length_pattern) then
+                        res = res // &
+                                & string(last : s_i - length_pattern) // &
+                                & replacement
+                        last = s_i + 1
+                        p_i = 0
+                    end if
+                    s_i = s_i + 1
+                    p_i = p_i + 1
+                else if (p_i > 1) then
+                    p_i = lps_array(p_i - 1) + 1
+                else
+                    s_i = s_i + 1
+                end if
+            end do
+        end if
+        
+        res = res // string(last : length_string)
+
+    end function replace_all_char_char_char
 
 end module stdlib_strings

src/tests/string/test_string_functions.f90

@@ -4,7 +4,7 @@ module test_string_functions
     use stdlib_error, only : check
     use stdlib_string_type, only : string_type, assignment(=), operator(==), &
                                     to_lower, to_upper, to_title, to_sentence, reverse
-    use stdlib_strings, only: slice, find                                    
+    use stdlib_strings, only: slice, find, replace_all                                   
     use stdlib_optval, only: optval
     use stdlib_ascii, only : to_string
     implicit none
@@ -63,102 +63,102 @@ subroutine test_slice_string
         ! Only one argument is given
           ! Valid
           call check(slice(test_string, first=10) == "jklmnopqrstuvwxyz", &
-                    "Slice, Valid arguments: first=10") ! last=+inf
+                    "slice, Valid arguments: first=10") ! last=+inf
           call check(slice(test_string, last=10) == "abcdefghij", &
-                    "Slice, Valid arguments: last=10") ! first=-inf
+                    "slice, Valid arguments: last=10") ! first=-inf
           call check(slice(test_string, stride=3) == "adgjmpsvy", &
-                    "Slice, Valid arguments: stride=3") ! first=-inf, last=+inf
+                    "slice, Valid arguments: stride=3") ! first=-inf, last=+inf
           call check(slice(test_string, stride=-3) == "zwtqnkheb", &
-                    "Slice, Valid arguments: stride=-3") ! first=+inf, last=-inf
+                    "slice, Valid arguments: stride=-3") ! first=+inf, last=-inf
 
           ! Invalid
           call check(slice(test_string, first=27) == "", &
-                    "Slice, Invalid arguments: first=27") ! last=+inf
+                    "slice, Invalid arguments: first=27") ! last=+inf
           call check(slice(test_string, first=-10) == "abcdefghijklmnopqrstuvwxyz", &
-                    "Slice, Invalid arguments: first=-10") ! last=+inf
+                    "slice, Invalid arguments: first=-10") ! last=+inf
           call check(slice(test_string, last=-2) == "", &
-                    "Slice, Invalid arguments: last=-2") ! first=-inf
+                    "slice, Invalid arguments: last=-2") ! first=-inf
           call check(slice(test_string, last=30) == "abcdefghijklmnopqrstuvwxyz", &
-                    "Slice, Invalid arguments: last=30") ! first=-inf
+                    "slice, Invalid arguments: last=30") ! first=-inf
           call check(slice(test_string, stride=0) == "abcdefghijklmnopqrstuvwxyz", &
-                    "Slice, Invalid arguments: stride=0") ! stride=1
+                    "slice, Invalid arguments: stride=0") ! stride=1
 
         ! Only two arguments are given
           ! Valid
           call check(slice(test_string, first=10, last=20) == "jklmnopqrst", &
-                    "Slice, Valid arguments: first=10, last=20")
+                    "slice, Valid arguments: first=10, last=20")
           call check(slice(test_string, first=7, last=2) == "gfedcb", &
-                    "Slice, Valid arguments: first=7, last=2") ! stride=-1
+                    "slice, Valid arguments: first=7, last=2") ! stride=-1
           call check(slice(test_string, first=10, stride=-2) == "jhfdb", &
-                    "Slice, Valid arguments: first=10, stride=-2") ! last=-inf
+                    "slice, Valid arguments: first=10, stride=-2") ! last=-inf
           call check(slice(test_string, last=21, stride=-2) == "zxv", &
-                    "Slice, Valid arguments: last=21, stride=-2") ! first=+inf
+                    "slice, Valid arguments: last=21, stride=-2") ! first=+inf
 
           ! Atleast one argument is invalid
           call check(slice(test_string, first=30, last=-3) == "zyxwvutsrqponmlkjihgfedcba", &
-                    "Slice, Invalid arguments: first=30, last=-3")
+                    "slice, Invalid arguments: first=30, last=-3")
           call check(slice(test_string, first=1, last=-20) == "a", &
-                    "Slice, Invalid arguments: first=1, last=-20")
+                    "slice, Invalid arguments: first=1, last=-20")
           call check(slice(test_string, first=7, last=-10) == "gfedcba", &
-                    "Slice, Invalid arguments: first=7, last=-10")
+                    "slice, Invalid arguments: first=7, last=-10")
           call check(slice(test_string, first=500, last=22) == "zyxwv", &
-                    "Slice, Invalid arguments: first=500, last=22")
+                    "slice, Invalid arguments: first=500, last=22")
           call check(slice(test_string, first=50, last=27) == "", &
-                    "Slice, Invalid arguments: first=50, last=27")
+                    "slice, Invalid arguments: first=50, last=27")
           call check(slice(test_string, first=-20, last=0) == "", &
-                    "Slice, Invalid arguments: first=-20, last=0")
+                    "slice, Invalid arguments: first=-20, last=0")
           call check(slice(test_string, last=-3, stride=-2) == "zxvtrpnljhfdb", &
-                    "Slice, Invalid arguments: last=-3, stride=-2") ! first=+inf
+                    "slice, Invalid arguments: last=-3, stride=-2") ! first=+inf
           call check(slice(test_string, last=10, stride=0) == "abcdefghij", &
-                    "Slice, Invalid arguments: last=10, stride=0") ! stride=1
+                    "slice, Invalid arguments: last=10, stride=0") ! stride=1
           call check(slice(test_string, first=-2, stride=-2) == "", &
-                    "Slice, Invalid arguments: first=-2, stride=-2") ! last=-inf
+                    "slice, Invalid arguments: first=-2, stride=-2") ! last=-inf
           call check(slice(test_string, first=27, stride=2) == "", &
-                    "Slice, Invalid arguments: first=27, stride=2") ! last=+inf
+                    "slice, Invalid arguments: first=27, stride=2") ! last=+inf
           call check(slice(test_string, last=27, stride=-1) == "", &
-                    "Slice, Invalid arguments: last=27, stride=-1") ! first=+inf
+                    "slice, Invalid arguments: last=27, stride=-1") ! first=+inf
 
         ! All three arguments are given
           ! Valid
           call check(slice(test_string, first=2, last=16, stride=3) == "behkn", &
-                    "Slice, Valid arguments: first=2, last=16, stride=3")
+                    "slice, Valid arguments: first=2, last=16, stride=3")
           call check(slice(test_string, first=16, last=2, stride=-3) == "pmjgd", &
-                    "Slice, Valid arguments: first=16, last=2, stride=-3")
+                    "slice, Valid arguments: first=16, last=2, stride=-3")
           call check(slice(test_string, first=7, last=7, stride=-4) == "g", &
-                    "Slice, Valid arguments: first=7, last=7, stride=-4")
+                    "slice, Valid arguments: first=7, last=7, stride=-4")
           call check(slice(test_string, first=7, last=7, stride=3) == "g", &
-                    "Slice, Valid arguments: first=7, last=7, stride=3")
+                    "slice, Valid arguments: first=7, last=7, stride=3")
           call check(slice(test_string, first=2, last=6, stride=-1) == "", &
-                    "Slice, Valid arguments: first=2, last=6, stride=-1")
+                    "slice, Valid arguments: first=2, last=6, stride=-1")
           call check(slice(test_string, first=20, last=10, stride=2) == "", &
-                    "Slice, Valid arguments: first=20, last=10, stride=2")
+                    "slice, Valid arguments: first=20, last=10, stride=2")
 
           ! Atleast one argument is invalid
           call check(slice(test_string, first=20, last=30, stride=2) == "tvxz", &
-                    "Slice, Invalid arguments: first=20, last=30, stride=2")
+                    "slice, Invalid arguments: first=20, last=30, stride=2")
           call check(slice(test_string, first=-20, last=30, stride=2) == "acegikmoqsuwy", &
-                    "Slice, Invalid arguments: first=-20, last=30, stride=2")
+                    "slice, Invalid arguments: first=-20, last=30, stride=2")
           call check(slice(test_string, first=26, last=30, stride=1) == "z", &
-                    "Slice, Invalid arguments: first=26, last=30, stride=1")
+                    "slice, Invalid arguments: first=26, last=30, stride=1")
           call check(slice(test_string, first=1, last=-20, stride=-1) == "a", &
-                    "Slice, Invalid arguments: first=1, last=-20, stride=-1")
+                    "slice, Invalid arguments: first=1, last=-20, stride=-1")
           call check(slice(test_string, first=26, last=20, stride=1) == "", &
-                    "Slice, Invalid arguments: first=26, last=20, stride=1")
+                    "slice, Invalid arguments: first=26, last=20, stride=1")
           call check(slice(test_string, first=1, last=20, stride=-1) == "", &
-                    "Slice, Invalid arguments: first=1, last=20, stride=-1")
+                    "slice, Invalid arguments: first=1, last=20, stride=-1")
 
         test_string = ""
         ! Empty string input
         call check(slice(test_string, first=-2, last=6) == "", &
-                    "Slice, Empty string: first=-2, last=6")
+                    "slice, Empty string: first=-2, last=6")
         call check(slice(test_string, first=6, last=-2) == "", &
-                    "Slice, Empty string: first=6, last=-2")
+                    "slice, Empty string: first=6, last=-2")
         call check(slice(test_string, first=-10) == "", &
-                    "Slice, Empty string: first=-10") ! last=+inf
+                    "slice, Empty string: first=-10") ! last=+inf
         call check(slice(test_string, last=10) == "", &
-                    "Slice, Empty string: last=10") ! first=-inf
+                    "slice, Empty string: last=10") ! first=-inf
         call check(slice(test_string) == "", &
-                    "Slice, Empty string: no arguments provided")
+                    "slice, Empty string: no arguments provided")
 
     end subroutine test_slice_string
 
@@ -170,27 +170,27 @@ subroutine test_find
         test_pattern_2 = "abccbabc"
 
         call check(all(find([test_string_1, test_string_2], test_pattern_1, 4) == [7, 0]), &
-            & 'Find: [test_string_1, test_string_2], test_pattern_1, 4')
+            & 'find: [test_string_1, test_string_2], test_pattern_1, 4')
         call check(all(find(test_string_1, [test_pattern_1, test_pattern_2], 3, .false.) == [9, 0]), &
-            & 'Find: test_string_1, [test_pattern_1, test_pattern_2], 3, .false.')
+            & 'find: test_string_1, [test_pattern_1, test_pattern_2], 3, .false.')
         call check(find(test_string_1, test_pattern_1, 7) == 0, &
-            & 'Find: test_string_1, test_pattern_1, 7')
+            & 'find: test_string_1, test_pattern_1, 7')
         call check(all(find([test_string_1, test_string_2, test_string_2], [test_pattern_1, &
             & test_pattern_2, test_pattern_2], [7, 2, 2], [.true., .false., .true.]) == [0, 0, 6]), &
-            & 'Find: [test_string_1, test_string_2, test_string_2], [test_pattern_1, &
+            & 'find: [test_string_1, test_string_2, test_string_2], [test_pattern_1, &
             & test_pattern_2, test_pattern_2], [7, 2, 2], [.true., .false., .true.]')
         call check(find("qwqwqwqwqwqwqw", test_pattern_1) == 1, &
-            & 'Find: "qwqwqwqwqwqwqw", test_pattern_1')
+            & 'find: "qwqwqwqwqwqwqw", test_pattern_1')
         call check(all(find(test_string_1, ["qwq", "wqw"], 2) == [3, 4]), &
-            & 'Find: test_string_1, ["qwq", "wqw"], 2')
+            & 'find: test_string_1, ["qwq", "wqw"], 2')
         call check(find("qwqwqwqwqwqwqw", "qwq", 2, .false.) == 5, &
-            & 'Find: "qwqwqwqwqwqwqw", "qwq", 2, .false.')
+            & 'find: "qwqwqwqwqwqwqw", "qwq", 2, .false.')
         call check(find("", "") == 0, &
-            & 'Find: "", ""')
+            & 'find: "", ""')
         call check(find("", test_pattern_1) == 0, &
-            & 'Find: "", test_pattern_1')
+            & 'find: "", test_pattern_1')
         call check(find(test_string_1, "") == 0, &
-            & 'Find: test_string_1, ""')
+            & 'find: test_string_1, ""')
 
     end subroutine test_find
 
@@ -318,6 +318,66 @@ pure function carray_to_string(carray) result(string)
         string = transfer(carray, string)
     end function carray_to_string
 
+    subroutine test_replace_all
+        type(string_type) :: test_string_1, test_pattern_1, test_replacement_1
+        type(string_type) :: test_string_2, test_pattern_2, test_replacement_2
+        test_string_1 = "mutate DNA sequence: GTTATCGTATGCCGTAATTAT"
+        test_pattern_1 = "TAT"
+        test_replacement_1 = "ATA"
+        test_string_2 = "mutate DNA sequence: AGAGAGCCTAGAGAGAG"
+        test_pattern_2 = "AGA"
+        test_replacement_2 = "aga"
+
+        ! all 3 as string_type
+          call check(replace_all(test_string_1, test_pattern_1, test_replacement_1) == & 
+                    & "mutate DNA sequence: GTATACGATAGCCGTAATATA", &
+                    & "replace_all: all 3 string_type, test case 1")
+          call check(replace_all(test_string_2, test_pattern_2, test_replacement_2) == &
+                    & "mutate DNA sequence: agaGAGCCTagaGagaG", &
+                    & "replace_all: all 3 string_type, test case 2")
+          call check(replace_all(test_string_2, test_pattern_2, test_replacement_1) == &
+                    & "mutate DNA sequence: ATAGAGCCTATAGATAG", &
+                    & "replace_all: all 3 string_type, test case 3")
+        
+        ! 2 as string_type and 1 as character scalar
+          call check(replace_all(test_string_1, "tat", test_replacement_1) == &
+                    & "muATAe DNA sequence: GTTATCGTATGCCGTAATTAT", &
+                    & "replace_all: 2 string_type & 1 character scalar, test case 1")
+          call check(replace_all(test_string_2, test_pattern_2, "GC") == &
+                    & "mutate DNA sequence: GCGAGCCTGCGGCG", &
+                    & "replace_all: 2 string_type & 1 character scalar, test case 2")
+          call check(replace_all("mutate DNA sequence: AGAGAGCCTAGAGAGAG", test_pattern_2, &
+                    & test_replacement_2) == "mutate DNA sequence: agaGAGCCTagaGagaG", &
+                    & "replace_all: 2 string_type & 1 character scalar, test case 3")
+
+        
+        ! 1 as string_type and 2 as character scalar
+          call check(replace_all(test_string_1, "TAT", "ATA") == &
+                    & "mutate DNA sequence: GTATACGATAGCCGTAATATA", &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 1")
+          call check(replace_all("mutate DNA sequence: AGAGAGCCTAGAGAGAG", test_pattern_2, &
+                    & "GC") == "mutate DNA sequence: GCGAGCCTGCGGCG", &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 2")
+          call check(replace_all("mutate DNA sequence: GTTATCGTATGCCGTAATTAT", "TA", &
+                    & test_replacement_2) == "mutate DNA sequence: GTagaTCGagaTGCCGagaATagaT", &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 3")
+          call check(replace_all("mutate DNA sequence: GTTATCGTATGCCGTAATTAT", &
+                    & test_pattern_1, "") == "mutate DNA sequence: GTCGGCCGTAAT", &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 4")
+          call check(replace_all(test_string_1, "", "anything here") == test_string_1, &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 5")
+          call check(replace_all("", test_pattern_2, "anything here") == "", &
+                    & "replace_all: 1 string_type & 2 character scalar, test case 6")
+        
+        ! all 3 as character scalar
+          call check(replace_all("mutate DNA sequence: GTTATCGTATGCCGTAATTAT", &
+                    & "GT", "gct") == "mutate DNA sequence: gctTATCgctATGCCgctAATTAT", &
+                    & "replace_all: all 3 character scalar, test case 1")
+          call check(replace_all("", "anything here", "anything here") == "", &
+                    & "replace_all: all 3 character scalar, test case 2")
+
+    end subroutine test_replace_all
+
 end module test_string_functions
 
 
@@ -333,5 +393,6 @@ program tester
     call test_slice_string
     call test_slice_gen
     call test_find
+    call test_replace_all
 
 end program tester