Skip to content

Latest commit

 

History

History
executable file
·
129 lines (96 loc) · 6.34 KB

README.md

File metadata and controls

executable file
·
129 lines (96 loc) · 6.34 KB

MAUDE: Mean Alterations Using Discrete Expression

DOI

MAUDE is an R package for finding differences in means of normally distributed (or nearly so) data, via measuring abundances in discrete bins. For example, a pooled CRISPRi screen with expression readout by FACS sorting into discrete bins and sequencing the abundances of the guides in each bin. Most of the documentation and examples are written with a CRISPRi-type sorting screen in mind, but there is no reason why it can't be used for any experiment where normally distributed expression values are read out via abundances in discrete expression bins. For example, MAUDE can also be used for CRISPR base editor screens where the readout is expression of a target gene, and reporter assays with expression readouts (e.g. Rafi et al).

See 'Usage' below for more information.

Maude Flanders

Table of contents

R Installation

Option 1: Install directly from GitHub

If you don't already have devtools, install it:

install.packages("devtools")

Load devtools and install from the GitHub page:

devtools::install_github("de-Boer-Lab/MAUDE")

Option 2: Install from download

Download the latest MAUDE release (Under "Releases" on the right hand side of this page).

Decompress the directory contained within it (something like "MAUDE-1.0.2").

Then in R: If you don't already have devtools, install it:

install.packages("devtools")

Then install in R using:

devtools::install_local("C:\\Users\\cdeboer\\Downloads\\MAUDE-1.0.2")

Requirements

Right now we have three main requirements:

  1. Negative control guides are included in the experiment; (these are used for calibrating Z-scores and P-values, and so are not strictly needed if only the expression means are desired).
  2. The abundance of the guides must have been measured somehow (usually by sequencing the guide DNA of unsorted cells; though there are ways to estimate this post-sort if the bins cover the majority of the distribution)
  3. The fractions of cells sorted into each expression bin was quantified (typically the cell counts/fractions read off of the cell sorter)

Usage

Tutorials

We provide two tutorials on how to run a MAUDE analysis in R here:

  1. Re-analysis of CD69 screen data
  2. Analysis of a simulated screen
  3. Analysis of a CRISPR base editor non-coding mutation screen

For additional examples, see the script for evaluating and comparing sorting-based CRISPR screen analysis methods.

Quantifying guide DNA abundance

After sequencing, you get fastqs, one per sorting bin and experiment. The first step for a MAUDE analysis is to quantify the number of guides residing in each bin. Here, we provide some guidance as to how to do this.

We have previously used the aligner bowtie2.

To make the bowtie2 reference guide_seq_reference:

bowtie2-build guide_seqs.fa guide_seq_reference

where guide_seqs.fa is a fasta file including the sequences you are mapping against, which will include the guide DNA sequence and any flanking constant regions as well. The amount of constant sequence you include in the reference should be at least as much as what was sequenced.

For example, with 20bp guides with constant flanking GTTTAAGAGCTATGCTGGAAACAGCATAG:

>guide1
GTCGCATATCGCGATAGCGAGTTTAAGAGCTATGCTGGAAACAGCATAG
>guide2
GTCGTGAAAGTGCTGTTGAGGTTTAAGAGCTATGCTGGAAACAGCATAG
...

The following command is an example of how to quantify guide abundance into a format that can easily be input into R for MAUDE analysis:

bowtie2 --no-head -x guide_seq_reference -U $sample.fastq.gz -S $sample.mapped.sam
#here, we include all mapped reads, but by using Samtools, you can filter out reads that map to the wrong strand, have indels, etc.
cat $sample.mapped.sam | awk '{print $3}' | sort | uniq -c | sort > $sample.counts

Here, $sample is the sample name, with $sample.fastq.gz the corresponding fastq file, and guide_seq_reference is the bowtie2 reference. The file $sample.counts will contain guide counts that can be input into R.

To turn this into a format that can easily be used for a MAUDE analysis, you can input the data using something like the following:

#here, allSamples is a data.frame containing one sample per row, with columns including ID, expt, and Bin.  There should be one file for every row in allSamples
allData = data.frame();
for (i in 1:nrow(allSamples)){
  curData = read.table(file=sprintf("%s/%s.counts",inDir,allSamples$ID[i]), quote="", header = F, row.names = NULL, stringsAsFactors = F)
  names(curData) = c("count","guideID");
  curData = curData[curData$gID!="*",] # remove unmapped counts
  curData$ID = allSamples$ID[i];
  curData$expt = allSamples$expt[i];
  curData$Bin = allSamples$Bin[i];
  allData = rbind(allData, curData)
}
#now you have the data in a data.frame that can be reshaped to a MAUDE-compatible format:
library(reshape)
allDataCounts = as.data.frame(cast(allData, expt + guideID ~ Bin, value="count"));
allDataCounts[is.na(allDataCounts)]=0; # fill in 0s for guides not observed at all
#now you just need to label the non-targeting guides and this will be in the correct format

Encountering problems

Should you encounter a problem using MAUDE:

  1. Consult the Common Problems
  2. Submit an Issue
  3. Contact the authors.

Citation

Please cite:

Carl G de Boer*, John P Ray*, Nir Hacohen, Aviv Regev. MAUDE: Inferring Expression Changes in Sorting-Based CRISPR Screens. 2020 Jun 3;21(1):134. doi: 10.1186/s13059-020-02046-8. PMID: 32493396.