Merge branch 'feature/string-compression' into develop

Author: codejsha

README.md

@@ -1249,6 +1249,7 @@ var str = collection.stream()
 
 **Examples**
 
+- Bit compression, CCSP#1.2: [python](python-algorithm/algorithm/string) | Compress a string using bit manipulation.
 - Convert string, EPI#6.1: [c++](cpp-algorithm/src/string)(`IntToString`, `StringToInt`) | Convert integer to string and vice versa.
 - IP address validation, EPI#6.9: [c++](cpp-algorithm/src/string) | Validate IPv4 address that is in the form of _x.x.x.x_ where _x_ is a number between 0 and 255.
 - Look and say problem, EPI#6.7: [c++](cpp-algorithm/src/string)

python-algorithm/algorithm/string/bit_compression.py

@@ -0,0 +1,37 @@
+class CompressedGene:
+    def __init__(self, gene: str) -> None:
+        self._compress(gene)
+
+    def __str__(self) -> str:  # string representation for pretty printing
+        return self.decompress()
+
+    def _compress(self, gene: str) -> None:
+        self.bit_string: int = 1  # start with sentinel
+        for nucleotide in gene.upper():
+            self.bit_string <<= 2  # shift left two bits
+            if nucleotide == 'A':  # change last two bits to 00
+                self.bit_string |= 0b00
+            elif nucleotide == 'C':  # change last two bits to 01
+                self.bit_string |= 0b01
+            elif nucleotide == 'G':  # change last two bits to 10
+                self.bit_string |= 0b10
+            elif nucleotide == 'T':  # change last two bits to 11
+                self.bit_string |= 0b11
+            else:
+                raise ValueError('Invalid Nucleotide:{}'.format(nucleotide))
+
+    def decompress(self) -> str:
+        gene: str = ''
+        for i in range(0, self.bit_string.bit_length() - 1, 2):  # - 1 to exclude sentinel
+            bits: int = self.bit_string >> i & 0b11  # get just 2 relevant bits
+            if bits == 0b00:  # A
+                gene += 'A'
+            elif bits == 0b01:  # C
+                gene += 'C'
+            elif bits == 0b10:  # G
+                gene += 'G'
+            elif bits == 0b11:  # T
+                gene += 'T'
+            else:
+                raise ValueError('Invalid bits:{}'.format(bits))
+        return gene[::-1]  # [::-1] reverses string by slicing backward

python-algorithm/algorithm/string/test/test_bit_compression.py

@@ -0,0 +1,19 @@
+from sys import getsizeof
+
+import pytest
+
+import algorithm.utils.logging as log_utils
+from algorithm.string.bit_compression import CompressedGene
+
+
+@pytest.mark.benchmark(group='gene_string_compression')
+def test_bit_compression(benchmark):
+    logger = log_utils.get_console_logger(__name__, 'DEBUG')
+    original: str = 'TAGGGATTAACCGTTATATATATATAGCCATGGATCGATTATATAGGGATTAACCGTTATATATATATAGCCATGGATCGATTATA' * 100
+    compressed: CompressedGene = benchmark(CompressedGene, original)
+
+    print('')
+    logger.debug('original is {} bytes'.format(getsizeof(original)))
+    logger.debug('compressed is {} bytes'.format(getsizeof(compressed.bit_string)))
+
+    assert original == compressed.decompress()